Taxonomy terms

Vous êtes ici

X

le spectre de ma voix
Introduction

  • document d'archive

  • document d'archive

La vie est une vision ? Ma voix est le spectre sonore de ma vision, la vie qui se diffuse.

La femme est orale ? Elle est « transe–mission ». Le son est granulaire ? Le son désarticule le langage, la voix est mixée puis remixée jusqu’à ne plus pouvoir l’identifier, m’identifier, elle est en marge de l’audible. Os, air, violence.

C’est seulement dans l’instabilité de la vie que je deviens nouvelle. Par exemple quand la vie me trouble je ne peux devenir qu’une voix.

Voix

X

le spectre de ma voix
Document 1

Le travail oral suit mes recherches plastiques sur la transformation de l’être, sa mutation, sa fiction. L’espace sonore est activé par un décrochement vocal qui déstabilise et qui renvoi l’écoute mnésique dans un hors temps.

— voix (d£.space), Olivier Bonny

Voix

X

le spectre de ma voix
Document 2

Une version orale et écrite d’une correspondance. J’ai oralisé ou transcrit une suite de mots qui traduisaient l’idée d’« un » des féminismes. Ces mots ont été échangés par correspondance avec Véronique Danneels. Ils sont inscrits dans la vidéo et enregistrés sur mini–disque puis gravés sur cd pour une transmission orale.

document d'archive
Voix

X

le spectre de ma voix
Document 3

  • document d'archive

  • document d'archive

Les naissances, les morts, les renaissances, l’amour, les désirs, la folie, le secret, les guerres, les blessures actionnent ma vision. Le vide, l’inconscience, l’invention, l’inaccessible, l’impuissance actionnent mon souffle. Tout est là.

Voix

X

le spectre de ma voix
Document 4

  • document d'archive

  • document d'archive

J’ai rassemblé par intérêt documentaire tous les documents ayant servi aux expériences sonores. Micro. Tuyau de laboratoire en caoutchouc. Néons. Instrument de laboratoire en verre. Biberon pour agneau en terre. La mélancolie, reproduction de Domenico Fetti. Une côte humaine. Capteur sonore. Ecouteurs. Reproduction, squelette reconstitué de l’homme de Spy (Namur) trouvé en 1886, Institut royal des Sciences naturelles de Belgique. Statuette africaine en bois. Inhalateurs. Livres : actes d’un procès pour viol en 1612 suivis des lettres d’Artemisia Gentileschi éd. Des femmes. L’insoumise, Laure Adler, éd. Actes Sud, (Simone Weil). Carnet de notes. Le Génie féminin, Hannah Arendt, éd. Fayard.

Voix

X

le spectre de ma voix
Document 5

Pénétration, notes vocales, langue inconnue:

 

ppppppplappéppppppénnénéétratioonnnnnnxxx

xxxxexxxxssssssssssssssssssexttttttasssssssss

sssssssssssssssssssssssssssssspppppppppppp

pppppppppépépépépépnnnnnnnnnnnntrationtra

tiontrationtiontiontionooooooooooooooooooooo

oooooooooooolapppppppplapelllllllllleleconcontt

tacctcctcctctctctctcttttttttxcsssssssssssssssssss

ssssssssxxxxxxxxxx xxllllappénéttrattttiontiontio

ntioncontttacctcctiontion tiontiontiontitontiotncon

contacctttcnladudududusex xxsxsssventrrrrrrre

yeuuxyeuxyeuuxieuieuieuieuieullllllllllllpénétratra

tiontiontionsexxxxxxxxxxxxxxeaaapppapapaaaa

aaaaaaaaaaaaaaaaaaparitiontiontiondededddd

l’l’l’l’l’l’lexssstassssssssssexxxtasseeeseeeeeee

eeeeeeeeeeeeeeeeeeeeeeeeeeeexxxxxxxxxxx

xxxxxxttttttttttttttttttttttaaaaaaaaaaaaaasessssss

ssssssssssxxxxxxxxxxxxxxxxdelapépéppppppp

pppppénétrati onddissssssssssssssssspaarition

didiisssspappapapaaaaaaaaaappppppppppppp

ppparitionionionionioni onionionionionioniooooo

oooooooooooooooooooooooooooooooooooooo

oooooooooooooooooooooooooooooooooooooo

 

Voix

X

le spectre de ma voix
document 6
document d'archive
Voix

Restez informé de notre actualité

X