Taxonomy terms

Vous êtes ici

X

le spectre de ma voix
document 1

Le travail oral suit mes recherches plastiques sur la transformation de l’être, sa mutation, sa fiction. L’espace sonore est activé par un décrochement vocal qui déstabilise et qui renvoi l’écoute mnésique dans un hors temps. Voix (do.space), Olivier Bonny.

X

le spectre de ma voix
document 3

Les naissances, les morts, les renaissances, l’amour, les désirs, la folie, le secret, les guerres, les blessures actionnent ma vision . Le vide, l’inconscience, l’invention, l’inaccessible, l’impuissance actionnent mon souffle. Tout est là.

X

Homepage

X

le spectre de ma voix
document 4

J’ai rassemblé par intérêt documentaire tous les documents ayant servi aux expériences sonores. Micro. Tuyau de laboratoire en caoutchouc. Néons. Instrument de laboratoire en verre. Biberon pour agneau en terre. La mélancolie, reproduction de Domenico Fetti. Une côte humaine. Capteur sonore. Ecouteurs. Reproduction, squelette reconstitué de l’homme de Spy (Namur) trouvé en 1886, Institut royal des Sciences naturelles de Belgique. Statuette africaine en bois. Inhalateurs. Livres : actes d’un procès pour viol en 1612 suivis des lettres d’Artemisia Gentileschi éd. Des femmes. L’insoumise, Laure Adler, éd. Actes Sud, (Simone Weil). Carnet de notes. Le Génie féminin, Hannah Arendt, éd. Fayard.

X

Contact

Dominique Vermeesch (do.space)

+32 (0)472 577 949

dominique.vermeesch@skynet.be

 

 

Contact Expositions

François Delvoye

francois@delvoyeurs.com

 

 

Contact

X

le spectre de ma voix
document 5

The P- Art Project.
Projet d’Edition international en Réseau initié par Paul Timmermans.

X

Newsletter
Newsletter

X

le spectre de ma voix
document 6

Pénétration : notes vocales, langue inconnue :

ppppppplappéppppppénnénéétratioonnnnnnxxxxxxxexxxxssssssssssssssssssexttttttassssssssssssssssssssssssssssssssssssssspppppppppppppppppppppépépépépépnnnnnnnnnnnntrationtrationtrationtiontiontionooooooooooooooooooooooooooooooooolapppppppplapelllllllllleleconcontttacctcctcctctctctctcttttttttxcsssssssssssssssssssssssssssxxxxxxxxxxxxllllappénéttrattttiontiontiontioncontttacctcctiontiontiontiontiontitontiotnconcontacctttcnladudududusexxxsxsssventrrrrrrreyeuuxyeuxyeuuxieuieuieuieuieullllllllllllpénétratrationtiontionsexxxxxxxxxxxxxxeaaapppapapaaaaaaaaaaaaaaaaaaaaaaparitiontiontiondededdddl’l’l’l’l’l’lexssstassssssssssexxxtasseeeseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeexxxxxxxxxxxxxxxxxttttttttttttttttttttttaaaaaaaaaaaaaasessssssssssssssssxxxxxxxxxxxxxxxxdela pépéppppppppppppénétrationddissssssssssssssssspaaritiondidiisssspappapapaaaaaaaaaapppppppppppppppparitionionionionionionionionionionioniooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooxxxxxxxxxxxxxxxxxxxxxxxxxxxxxssssssssssssssssssssssspppppppppppppppppppppppppppppppppppppppppppppaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaasexsexssexssssexsssssssexsssssssssexssssssssssssexsssssssssssssssexsssssssssssssexssssssssssssssssssssssssssssxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxpassssionionionionioniondellllaaaaaaaaaaaaaaaapppénétraaaaapppparriiiiiiitionsssssssssxsxsionionpasssionionionionononssssssexxxxxxxxxxxxxxx sssssexseappeellpppppppppéppppppénnénéétratioonnnnnnsexxxxxxxappppppptouchchchetouchtouchtouchechchchtttttotuchetouchchtttttttoutouchchcerconcontttacctcctccteeeeééééétttttllldidiisssspappapaparilaldispparitiontiontionpénéttrattttiontiontiontioncontttracctioncctlllaaaaadisparitionddiisssssapapladdispspsaritontiontiontionduconcontacctttcnladididispaririidusexxxsxsssdissssiparitioritionpénétratrationtiontionexeaaapppapapapritiontiontionxssstasexxxtassssssssssssssssssssssssssssssssssezezezezezzzzzzzzzzezezextassssssssssssssssssssssssssssssspppppénnénéétratioonnnnnnsexxxxxxxappapapapelelelleparrrleeeechchchetouchechchcherllllllllllllllllaaaaaaaaaaaaaaaaaaatouchchtouchchcccccccccccccccccccconcontttacctcctcctcpénétratrationtiontionssssssssexexssstasssssssssssssssssssssssssexxxtaseexexexsssssssssssssssssssssssssssssssssssssssxxxxxxtasepppppééééééééééééééééééééééénnnnnnnnétrationtionttiiiiiiiiiiiiiiiioniiiiiononn

X

edition
-

-2023

Monographie Ouïr le jamais vu et Tirage de tête contenant un vinyle réalisé avec le musicien daniel duchamP.
Edition La Lettre Volée.

Archives

X

performance
-

- 2023
Performance sonopoétique. Ouïr le jamais vu.
Entre Monde - ARTour art contemporain et patrimoine
Château Gilson, La Louvière, Belgique
Voix / texte (do.space) - Son / daniel duchamP
Coproduction Transcultures / City Sonic 20 ans / ARTour - Central

Voir pdf
Archives

X

performance
-

X

exposition
.

- 2023
Exposition solo Ouïr le jamais vu accompagnée d’une
lecture de François Delvoye et d’une performance poétique vibratoire de Philippe Franck: « Paradise Now + Isa*Belle - Un.do.Weil’sveil ».
A. Galerie Rue du page, 25 - Bruxelles - Belgique

Archives

X

exposition
-

- 2022

- Exposition, Traces de l’invisibles. Installation de l’oeuvre « Ouïr le jamais vu ».
Commissariat, Carine Fol. CBW, Paris/France
- Performance (do.space), « noir-soeur » CBW:Paris/France

Archives

X

EXPOSITION
_

- 2021
Exposition personnelle. Espace privé pour l’art contemporain Kamer negen /K9 - Rixensart - Belgique

X

EXPOSITION
_

- 2021
Exposition personnelle. Espace privé pour l’art contemporain Kamer negen /K9 - Rixensart - Belgique

Archives

X

editiON
_

- 2021
micro [scopie]. Edition (do.space).
Leporello with vinyl. Collaborations: François Delvoye - daniel duchamP
https://dominiquevermeesch.be/en/informations/edition

Archives

X

exposition
_

- 2019
City Sonic
Teinté[e] ⟷ Tinté[e]
Installation sonore
Faculté de Théologie, UCLouvain Descamps, 1348 Louvain la Neuve, Belgique
http://citysonic.be/festival2019/

Archives

X

exposition
-

- 2019
performance (do.space) et
intervention de François Delvoye, commissaire de l'exposition
dans le cadre de AVE LUÏA, un regard brut sur l'art religieux
Les nocturnes du jeudi le 20/06/19 à 18:00h
Musée Provincial des Arts Anciens du Namurois
Rue de Fer 24, 5000 Namur

Archives

X

exposition
-

​H8X12
Horenweg 37
B-3390 Tielt-Winge
http://h8x12.be/iib/

document d'archive
Archives

X

exposition
rien

- 2019
Exposition d’une oeuvre appartenant à la collection de B. Oosterlynck.
Espace privé pour l’art contemporain Kamer negen /K9 - Rixensart - Belgique

Archives

X

information
-

Toutes informations contenues dans les pages "Actualité" sont régulièrement transférées et archivées dans les pages "Archives".
http://dominiquevermeesch.be/fr/informations/archives

Actualité

X

exposition
rien

- 2018
Présentation de mes oeuvres dans le cadre de l'exposition collective Actitudes Contemporaines Belges Versoix - Genève - Suisse
avec la participation de l'ASBL Delvoyeurs
Boléro - 8 chemin J.B. Vandelle - 1290 Versoix - Suisse
www.bolero-versoix.ch - bolero@versoix.ch

document d'archive "Actitudes Contemporaines" 2018
Archives

X

travail en cours
-


2024. Je ne vois pas, je voix.1951-3015
Performance in situ, cendres.

Actualité

X

performance
-

  • document d'archive

2023. Ouïr le jamais vu. Performance sonopoétique.
Entre Monde - ARTour art contemporain et patrimoine
Château Gilson, La Louvière, Belgique
Voix / texte (do.space) - Son / daniel duchamP
Coproduction Transcultures / City Sonic 20 ans / ARTour - Central
http://transcultures.be

Actualité

X

action
introduction

Dans mes performances j’introduis : un peu d’être + un peu d’organe + une civilisation X + une âme + un parasite dans l’œil + un acte créé sous X + une prise de conscience + un abandon de soi + (d£.space) + une grâce + une jouissance

Performance

X

MUSIQUE PERFORMANCES INSTALLATIONS EDITIONS
rien

- 2018
disponible
The Art of Silence
DVD édition 2018
P-ART projects http://users.skynet.be/P-ART/
démo: https://youtu.be/M9KMG7dshqQ
livret + DVD audio/video 15€
contact: daniel.duchamp@proximus.be

Archives

X

le spectre de ma voix
Introduction

La vie est une vision ? Ma voix est le spectre sonore de ma vision, la vie qui se diffuse.

La femme est orale ? Elle est « transe–mission ». Le son est granulaire ? Le son désarticule le langage, la voix est mixée puis remixée jusqu’à ne plus pouvoir l’identifier, m’identifier, elle est en marge de l’audible. Os, air, violence.

C’est seulement dans l’instabilité de la vie que je deviens nouvelle. Par exemple quand la vie me trouble je ne peux devenir qu’une voix.

Voix

X

performance
.......

  • document d'archive

2023. Ouïr le jamais vu. Performance sonopoétique.
Entre Monde - ARTour art contemporain et patrimoine
Château Gilson, La Louvière, Belgique
Voix / texte (do.space) - Son / daniel duchamP
Coproduction Transcultures / City Sonic 20 ans / ARTour - Central

X

performance
-

  • document d'archive

2023. Ouïr le jamais vu. Performance sonopoétique.
Entre Monde - ARTour art contemporain et patrimoine
Château Gilson, La Louvière, Belgique
Voix / texte (do.space) - Son / daniel duchamP
Coproduction Transcultures / City Sonic 20 ans / ARTour - Central

X

expositions
2017

- 2017
COLLECTE, COLLECTION, COLLECTIONNEUR, UN MONDE Á SOI
Dans le cadre de la 11e biennale ARTour
exposition d'une pièce dans la collection de Baudouin Oosterlynck,
au MiLL - Musée Ianchelevici, Place Communale 21 à La Louvière - Belgique
24.06 > 10.09.2017

Archives

X

supports et diffusion
Introduction

  • document d’archive

Conceptions / installations sonores ou visuelles, performances, expérimentations graphiques, perceptions, vidéos, documents photographiques imprimés ou gravés deviennent documents d’archives. Je les utilise comme banque de données. L’édition me permet de percevoir autrement mes recherches.
Ces éditions limitées réalisées à compte d’auteur sont disponibles à l'adresse suivante: dominique.vermeesch@skynet.be

Édition

X

le spectre de ma voix voix
_

  • ©jeanchristopheLett

2022 Ouïr le jamaisvu.
Je trace des sons internes.invus par l'oreille et par la bouche, une sorte de langue sonobscure W051 fondu.e au noir qui vibrrrhurle des non.sons (mots enfouis qui ne sortent pas du trou noir mon larynxxxss s).
Installation multimédias. Vidéo performance - voix - dessin - documents d’archives. Exposition Traces de l’Invisible. Centre Wallonie Bruxelles - Paris.

ouïr le jamaisvu
Voix

X

pensées nomades
Introduction

  • document d'archive

Quand je conçois, j’intègre dans mon travail photos, documents personnels, articles de journaux, livres, outils technologiques.

Je les associe, les mixe, les colle. Leur diffusion peut être sonore ou visuelle. L’ensemble forme une installation atemporelle, jamais fixe et qui aura plusieurs versions. Les éléments contenus dans l’ensemble passent d’une recherche à l’autre. C’est l’éternel commencement, transformation, disparition, renaissance. Ceci fait partie d’une pensée nomade, d’une conception d’un langage qui colle à ma propre vie.

Seul, le document avec ou sans son mémorise.

Pensées

X

action
_

  • document d'archive

  • document d'archive

2019 . teinté[e] ⟷ tinté[e]
Video performance / installation sonore
City sonic

Tout agit sur tout. Dans le sillon philosophique de Simone Weil, mon corps - perception, lieu de transformation se teinte ⟷ tinte de vibrations de l'univers. De cette interaction naît une voix intérieure articulée en mots - tons - touchés brouillés par les choses de ce monde. Anthropocène, affublée d'un harnais, connectée de signes antérieurs et néo - contemporains, mon âme - intériorité, fondation de la langue sonore de l'oeuvre devient capteur, émetteur, animal, grotte, extinctions, disque dur, amas stellaires, ondes de Valentina Terechkova, tous inséparables d'une écriture de contacts.

teinté[e] ⟷ tinté[e]
Performance

X

edition
.


2023. Monographie Ouïr le jamais vu. Editions La lettre Volée.

Tirage de tête contenant un vinyle réalisé avec le musicien daniel duchamP.

Actualité

X

exposition
.

  • ©jeanchristopheLett

2022. ouïr le jamaisvu. Installation. CWB / Paris / France
Commissariat: Carine Fol, Directrice artistique de la Centrale for contemporary art Bruxelles
Performance (do.space) "noir·soeur"
https://cwb.fr/agenda/les-traces-de-l-invisible

MinuteLucieLegenre-CWB
Actualité

X

pensées nomades
_

2018. магнитные затворы / Silences Magnétiques
Vidéo performance et voix.
Création sonore: daniel duchamP
Ed, DVD Project The Art of Silence, P-ART.

магнитные затворы
Voir pdf
Pensées

X

dessins, apparitions
introduction

  • document d'archive

Dessiner
Toucher /contacter

Introspection
Apparition

(Voix)

Dessin

X

le spectre de ma voix
_


Voix

X

supports et diffusion
micro [ scopie ]

micro [ scopie ] édition (do.space) 2021

Présentation de l'ouvrage édité à l'occasion des expositions de l'artiste à l'espace privé pour l'art contemporain Kamer Negen / K9, Rixensart et la A.Galerie, Bruxelles en 2022.

L'édition sous forme de leporello contient: écritures / dessins, photographie d'une performance de l'artiste Dominique Vermeesch (do.space), texte de François Delvoye, anthropologue + un vinyle 7" de quatre titres en collaboration avec daniel duchamP.

Impression en litho - photographie tirée à 40 exemplaires signés par (do.space) sur les presses de l'Atelier Bruno Robbe à Frameries.

ps: téléchargement des morceaux entiers, contacter: dominique.vermeesch@skynet.be

Édition

X

biographie
-

  • ©document d'archive

Dominique Vermeesch (do.space) travaille et développe ses questionnements par la notation-dessin-phonique, photographie, vidéo y compris son propre corps, notamment lors de performances qui offrent l’occasion d’un rendez-vous mystique avec ces ondes qu’elle guette, avec ce corps comme lieu d’inscription du monde, de l’histoire. Corps trouble vecteur de son travail mais pas de façon fixe, comme un tatouage, mais via les ondes-sonores-tactiles comme vibration transitoire. Ses questions sont en effet au centre du vaste réseau d’œuvres, de liens et de sens qu’elle met en place. Son travail nommé "langue de contact" est à aborder comme un tout, en continuelle expansion, en systématique remise en question. Outre sa création de dessin, son art repose sur le classement, le travail d’archives qu’elle fait parler aujourd’hui à sa manière, parcourant l’histoire et la philosophie des thèmes qui lui sont chers, mélangeant des documents existants avec ses œuvres, construisant de cette manière un monde de dialogues de textes, de sons et d’images, d’époques différentes, de cultures différentes. On y croise Hannah Arendt, Patti Smith, Simone Weil, Donna Haraway, aussi bien que des images du cosmos et de tout ce qui concerne la création, le corps, et toutes leurs mythologies. François Delvoye.
- Sélection d'expositions: Musée du Béguinage de la Maison d'Erasme (Bruxelles), Eglise St Jean Baptiste au Béguinage (Bruxelles), Musée Art et Marges (Bruxelles), Le Boléro -Versoix (Suisse), Musée Royal de Mariemont (La Louvière), Musée Rops (Namur), Musée de Louvain-La-Neuve (Louvain - La- Neuve), Centre Culturel de Tournai (Tournai), Maison de la Poésie (Namur), CWB (Paris)

À propos

X

interview
_

(do.space) La Transfiguration du corps-voix.
Interview réalisé par Philippe Franck-
Turbulences vidéo #114

Actualité

X

mon corps, capteur
Introduction

  • document d'archive

  • document d'archive

  • document d'archive

Tout contact et perceptions entre moi et la vie s’essayent et s’inventent. Quand je crée, mon corps se transforme en capteur. Avec mon corps, je perçois ainsi de façon« trans-organique »,

ce qui m’entoure.

 

J’utilise aussi tout autre objet qui permettent

au-delà des réseaux traditionnels de capter

la vie. Par exemple je fais glisser

un micro-capteursur ma peau et j’entends

un événement du monde qui se diffuse

dans mes cellules.

 

Les perceptions sont donc poussées à l’extrême des sens perceptifs humains. Mes yeux peuvent

toucher une main étrangère tatouée de sang,

ma joue sentir la violence politique en Lybie.

Quand les perceptions apparaissent, je les enregistre par prise de vue, enregistrement audio, notes graphiques.

Corps

X

expositions
2015

- 2015

Exposition/ Performance. Eglise Saint Jean Baptiste-au-Beguinage « Les sœurs Noires ».

Commissaire François Delvoye. 1000 Bruxelles - Belgique.

Presse:

- extrait de l'Art Même, n°66 -2015
- article Arte News -2015
- Le Delvoyeurs illustré N°1 -2015
http://delvoyeurs.com/EXPOSITION-BRUXELLES-DOMINIQUE-VERMEESCH
- earteam RIFRAF 217 -02/2016

document d'archive "Les Soeurs Noires" BXL 2015
Voir pdf , Voir pdf , Voir pdf , Voir pdf
Archives

X

action
-

  • document d'archive

2018. (l’éternité ?)
Installation multimédia. Vidéo-performance - dessins - documents d'archives

(l'éternité?)
Performance

X

action
-

  • ©LucPiron

2019. Par l’oreille et par la bouche
voix - Thérémin
H8 X 12 Tielt-Winge

Performance

X

le spectre de ma voix
Document 5

  • document d'archive

2016. Pénétration, notes vocales, langue inconnue

 

ppppppplappéppppppénnénéétratioonnnnnnxxx

xxxxexxxxssssssssssssssssssexttttttasssssssss

sssssssssssssssssssssssssssssspppppppppppp

pppppppppépépépépépnnnnnnnnnnnntrationtra

tiontrationtiontiontionooooooooooooooooooooo

oooooooooooolapppppppplapelllllllllleleconcontt

tacctcctcctctctctctcttttttttxcsssssssssssssssssss

ssssssssxxxxxxxxxx xxllllappénéttrattttiontiontio

ntioncontttacctcctiontion tiontiontiontitontiotncon

contacctttcnladudududusex xxsxsssventrrrrrrre

yeuuxyeuxyeuuxieuieuieuieuieullllllllllllpénétratra

tiontiontionsexxxxxxxxxxxxxxeaaapppapapaaaa

aaaaaaaaaaaaaaaaaaparitiontiontiondededddd

l’l’l’l’l’l’lexssstassssssssssexxxtasseeeseeeeeee

eeeeeeeeeeeeeeeeeeeeeeeeeeeexxxxxxxxxxx

xxxxxxttttttttttttttttttttttaaaaaaaaaaaaaasessssss

ssssssssssxxxxxxxxxxxxxxxxdelapépéppppppp

pppppénétrati onddissssssssssssssssspaarition

didiisssspappapapaaaaaaaaaappppppppppppp

ppparitionionionionioni onionionionionioniooooo

oooooooooooooooooooooooooooooooooooooo

oooooooooooooooooooooooooooooooooooooo

 

Voix

X

dessins, apparitions
_

  • document d'archive

2017 . Céleste

Dessin

X

£
introduction

  • Elyse Van de Vyvere-Plasky 1910

  • document d'archive

  • document d'archive

La bouche ouverte de Meredith Monk / l’archet de Charlotte Moorman / le droit d’auteure de Françoise Collin / le trouble identitaire de Judith Butler/ une femme X / le désir de Magdalena / les renaissances de Hannah Arendt / Julia Kristeva / la fluidité de la grâce de Simone Weil / la vie de Lee Miller / la table des éléments de Eliane Radigue / un son de Daphne Oram / les carnets auto-biographiques de Eva Hesse / la vie plurielle de Dorothée Richet / la prostituée X / les travestissements de la comtesse de Castioglione / le copier-coller politique de Anna Hoch / les carnets rouges sur les droits de la femme de mon arrière-grand-mère Elise Van de Vyvere / l’amour passage de Léona artiste surréaliste / la prière punk Mère de Dieu, Chase Poutine Away de Pussy Riot / les mots sensuels du 18 mars de Meret Oppenheim / la folie de Unica Zurn / l’extase jouissance de Thérèse d’Avila / la blancheur immatérielle des vierges / la coulée d’un geste de Pina Bausch / la femme désoeuvrée Rose Rrose de Marcel Duchamps / le viol-meurtre de Violette Nozière / l’organique contact de Lygia Clark / le sang blessure de Gina Pane / le procès révolte de Artémisia Gentileschi / l’homme-femme de Claude Cahun / les seins tranchés de sainte Agathe/ la planète sonore d’Ursula Bogner / …

$

X

pensées nomades
_

  • document d'archive

  • document d'archive

1990 - 2018 Pénétratum
Je ne suis que pénétration du monde. Ceci est mon corps transanthropocène

Pensées

X

action
document

  • document d'archive

Elle est une femme écran tactile prolongée d’un disque dur. Capteurs / diffuseurs / micro / objets d’archives mystiques connectés à un harnais / une âme.
Son : daniel duchamp, (do.space).
Performance conçue dans le cadre du colloque « Femmes mystiques d’Orient et d’Occident : éros et puissance créatrice ». Centre Omar Khayam avec la collaboration du CIERL (ULB) et la Maison d’Erasme.
Anderlecht / Bruxelles. Belgique. Musée du Béguinage « Les Sœurs Noires », commissaire François Delvoye

Performance

X

supports et diffusion
Féminique

  • document d'archive

  • document d'archive

Compilation, 3 cd, texte, photo. Voix / texte, (d£.space), son, Daniel Duchamp. Introduction Olivier Bonny.

Voir pdf
Édition

X

$
document

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

2015. Les Soeurs Noires

Inclassables
Néo-mutantes
Conceptrices
Transposées
Pensées
Visionnaires
Au-delà de l’histoire
Au-delà de l’image
Dans la descente du corps
Elles

Je meurs de ne pas mourir dans cette vision
-
Recherche réalisée pour l’exposition « Les Sœurs Noires ».
Commissaire François Delvoye. Eglise St Jean Baptiste. 1000 Bruxelles

$

X

Mon corps, capteur
Document 1

  • Document d'archive

Les yeux fermés je m’introduis dans mon être.

Je m’ouvre, me pénètre.

 

Les sensations éprouvées sont dans le même instant captées sur table d’écoute puis rediffusées sur haut–parleurs.

 

La voix sort du corps et des hauts–parleurs, elle m’envahit. L’univers ainsi que quelques documents préparatoires à l’expérience sont installés sur une table, ils servent à diffuser toute apparition mnésique.

Corps

X

expositions
2014

- 2014

Exposition/Performance. Musée du Béguinage « Les sœurs Noires ». Commissaire François Delvoye. Anderlecht, Bruxelles, Belgique. Conservatrice Ann Arend.

Performance dans le cadre du colloque « Femmes mystiques d’Orient et d’Occident : éros et puissance créatrice ». Centre Omar Khayam avec la collaboration du CIERL (ULB) et la Maison d’Erasme Musée du Béguinage « Les Sœurs Noires ». Commissaire François Delvoye. Anderlecht / Bruxelles. Belgique.

Archives

X

le spectre de ma voix
-

2017. Apesanteur

Voix

X

Vie
-

  • Mérédith Monk et Hannah Arendt

1951  Ouvrir ma bouche. Remplir mes organes d’hyper–sensations. Introduire dans mon corps six mains deux ventres trois seins huit yeux. Recevoir de petites morts comme celles de Martha Graham.

 

1957  Devenir œil - insecte.

 

1960  Avoir 14 ans. Être ♂ ou ♀ ou ? Avaler l’écume des jours de Boris Vian. 1965. Collectionner des reproductions de peintres et de femmes de cultures différentes.

 

1970  Entrer dans l’ère philosophique beat. Travestir mon corps. Vivre amour et connaissance d’Alan Watts. Mixer mes yeux, Jérôme Bosch, Marcel Broodthaers, Yoko Ono. Contrer l’outrance d’une société capitaliste.

 

1975  Créer un champ d’action. Sous exposer mon art, vivre d’essais, d’inachèvement, de désoeuvrement. Ecrire une pensée hybride. Prolonger ma main d’un appareil photographique. Agiter mon inconscient avec une machine à écrire. Ecouter les cris de Mérédith Monk. Planer avec La Monte Young. Lire La Pensée Sauvage de Lévis-Strauss.

 

1980  Détourner, renverser, inverser, bricoler, suraimer. Autoriser mon être à être femme et artiste. Participer aux revendications féministes. Compulser les cahiers du Grif, 331W20 de Françoise Collin. Affirmer le droit à l’homosexualité, le droit à mon avortement.

 

1990  Imprégner mon art de la philosophie deleuzienne. Devenir femme avec ou sans organes. Ôter mes os, les déposer dans d’autres vies. Être en état d’extase. Muter mes visages avec ceux de Claude Cahun.

 

1995  Transmettre des survivances socio–artistiques–post-humaines. Changer mon nom en (d£.space).

 

2000  Sentir l’explosion-missile irakienne. Enregistrer des ondes mnésiques. Fermer les yeux, trembler. Entourer mon corps de micros, cassettes audio, câbles, haut–parleurs. Habiter mon âme comme une chambre à soi. Elever deux filles.

 

2005  Diffuser des visionnaires : Hildegarde Von Bingen, Hannah Arendt, Simone Weil.

 

2009  Surfer sur You Tube les pensées de Judith Butler. Entendre Phillip Jeck. Evoluer à 300°.

 

2011  Faire un art xpoétik. Vaciller, me retirer, me renverser, mourir, copier- coller des visions, désarticuler

(d£.space)

 

2016  Etre en état d'apesanteur. Devenir astronaute. Emigrer sur la comète Shoemaker - Levy 9.

 

2017  Atterrir sur la montagne céleste Xinjiang dispataître dans un brouillard de cendres et puis retourner en soi

 

2018   Être finie. Eprouver cette sensation comme une grâce. Retenir la beauté d’Ingrid Bergman dans le film "Stromboli".

 

2019  Devenir transanthoropocène. Vomir mes cellules AXO3?. Modifier mon corps en caméléon Musae. Être en état d’éruption.

 

2020  Poudrer mon visage du blanc de l'iceberg Okjökull. Teinter mes sons de "rose ss s è une rose". Parler à la planète Mars. Pirater ma voix (e)      mon art

 

2021  Fabriquer des yeux-voix vibrrhurler la vie. Ecouter la poésie  transmentale de Varvara Stepanova

 

2022   Permuter mon être en pi·œuvre. Câbler mes tentacules aux choses enfouies de ce monde. Ejecter de la noirceur.   

 

2023  Etre essaim de bruits contagion de mots vivants vibrant allant et venant d’âme en âme être souffle cendre fumée … Victor Hugo, "Le seuil du gouffre1891"

 

2024  M’exhumer ⟷ m’inhumer dans la profondeur de mon inconscient

À propos

X

pensées nomades
Document 1

  • document d'archive

  • document d'archive

Un fichier contenant un stock de photos de planètes, un micro, un livre sur la vie d’Aby Warburg, une vénus anatomique, cachez ce sexe que je ne saurais voir éd. Dis voir 2003, un crâne inconnu, l’image d’une grotte, leurs associations.

Pensées

X

dessins, apparitions
document

  • document d'archive

  • document d'archive
Dessin

X

le spectre de ma voix
_

  • document d'archive

- 2019
Harnais sonore

Voix

X

$
document

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

Expérience mystique visionnaire. Un espace historique : Un béguinage construit en 1252.
Dans ce lieu, je réalise une communion avec les éléments d’archives. Je touche le passé/ présent celui de femmes univers. Je me transporte dans un « hors – temps, celui de l’expérience. J’utilise ma voix, mon âme.
Recherche réalisée pour l’exposition « Les Sœurs Noires ». Commissaire François Delvoye. Musée du Béguinage. Anderlecht / Bruxelles. Belgique.

$

X

action
document

2010 . X♀Wdo51
Elle est une femme qui contient Simone Weil / une âme / un corps défait / deux haut–parleurs à la place des seins / une vision.
Musée Art et Marges. Bruxelles. Belgique.
Participation : Camille Van Acker, son: daniel duchamP, (do.space).

document d'archive
Voir pdf
Performance

X

dessins, apparitions
document

  • document d'archive

  • document d'archive
Dessin

X

supports et diffusion
Post-vision

  • document d'archive

  • document d'archive

1 cd, 1 photo, texte. Voix / texte, (d£.space), son, Myriam Rouillard.

Voir pdf
Édition

X

expositions
2010

- 2010

Exposition/Performance. Musée Art et Marges, Corps Accorps, Bruxelles, Belgique. Conservatrice: Carine Fol

Presse:

François Delvoye, Le corps holistique de Dominique Vermeesch, Catalogue CORPS ACCORPS - BODY TALK, Musée Art et Marges, 2010

Voir pdf
Archives

X

pensées nomades
Document 2

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive
Pensées

X

mon corps, capteur
Document 2

  • document d'archive

1990/1999.  Introspicere

J’ai posé douze toiles sonores sur structures,

douze toiles qui diffusent des textes

se chevauchant en continuum.

Sur une table ont été posés un moniteur et

des documents d’archives.

Le son contient des interrogations,

des sensations / perceptions sur l’acte de conception. Les textes proviennent d’expériences de contact avec la profondeur de mon être.

Corps

X

$
document

J’ai posé sur une table, un micro, un livre de Simone Weil et l’univers. Ensuite, j’ai enregistré un fragment de texte de Simonne Weil concernant la décréation. En transmettant sa pensée, j’interrogeais ma création. Tout me semblait si vide, pourtant tout était là.

extrait document d'archive
$

X

action
document

Elle est une femme évolution / révolution érotiquement visionnaire.
Musée Rops. Belgique. Basse / chant, The plastic Strawberries Need Stitches, body - painting, Alexandra Lameir, son, daniel duchamP, (do.space)

extrait document d'archive
Performance

X

supports et diffusion
Catalogue Dominique Vermeesch (d£.space)

  • document d'archive

Collaboration Dominique Vermeesch, Annabelle Dupret, Jean-Grégoire Savayan, éd. Polymorphe, 2008.

Voir pdf
Édition

X

expositions
2008

- 2008

- Performance. Musée Rops, Hammadryennes, Namur, Belgique

Presse: Hélène Carpiau, Quand le nu sort du tableau, La Meuse, septembre 2008

- Catalogue Dominique Vermeesch (d£.space), Dominique Vermeesch, Annabelle Dupret, Jean-Grégoire Savayan, ed. Polymorphe

Archives

X

le spectre de ma voix
_

  • document d'archive

2015 . ’’E?SoJ

Voix

X

pensées nomades
document 3

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

J’ai découvert ces cœurs provenant de la collection Boyadjian dans une réserve du Musée de Louvain–la–Neuve. Je les ai intégrés dans diverses expériences : photos, vidéos, performances, … Lorsque je touchais ces cœurs, je touchais les renaissances, les battements, les amours. Mon corps a retenu la vision de cette image ; depuis, une excroissance s’est développée en moi.
J’ai plusieurs cœurs, plusieurs vies.

document d'archive
Pensées

X

dessins, apparitions
document

  • document d'archive
Dessin

X

mon corps, capteur
Document 3

  • document d'archive

  • document d'archive

  • document d'archive

Je sens la chaleur de mon sang, je capte des

instants de vie. Je deviens juste une vision.

L’expérience photographiée devient document.

La photo est mise en circulation. Elle s’installe dans mon lieu d’habitation où l’action s’est déroulée puis apparaît dans d’autres situations expérimentales.

Corps

X

mon corps, capteur
Document 4

1996 . mains

Influencée par les écrits de Merleau–Ponty,

j’ai appliqué quelques expériences personnelles

à partir de sa phénoménologie de la perception.

Au sein des applications, j’ai pris conscience que

mon être était une plaque sensible.

J’étais bio–sismique. Je suis le matériau de mon

art, un lieu de gestation et donc d’action.

Ici, comme dans d’autres travaux, je poursuis

les actions performatives propres aux femmes

artistes et auteures qui m’ont précédées par exemple dans les années 70, Carolee Schneemann.

document d'archive
Corps

X

$
document

J’ai conçu un hommage à la vie de Lee Miller, femme photographe, par un diaporama réalisé à base d’images d’archives. La vie de Lee Miller est une création, sa vie est son oeuvre. Dans cet hommage, image après image, j’ouvre une vie photographiée, celle de ma vie-conception.

extrait document d'archive
$

X

DESSINS, APPARITIONS
document

  • document d'archive

2014. (do.space)

Dessin

X

le spectre de ma voix
_

Le travail oral suit mes recherches plastiques sur la transformation de l’être, sa mutation, sa fiction. L’espace sonore est activé par un décrochement vocal qui déstabilise et qui renvoi l’écoute mnésique dans un hors temps.

— voix (d£.space), Olivier Bonny

Voix

X

supports et diffusion
Bucca

  • document d'archive

L’extraordinaire est de se réinventer, trouver une autre position dans l’univers. Construire un biotope sonore et visuel en est une façon. Je livre cet espace comme mon corps afin qu’il se dissolve dans le monde. Eau et sang, gestation, conception (do.space)

DVD : voix / texte, (d£.space), son, Daniel Duchamp, conception pochette, The plastic Strawberries Need Stitches.

document d'archive
Édition

X

expositions
2007

- 2007

Vidéo. ISELP - Performance-débat organisé par le Périodique Collimateur, projection du Film Bucca, "Art, produit sans recettes", Bruxelles, Belgique

- 2007

La Collection 1998 > 2006 de la Province du Brabant Wallon.
Domaine Provincial du Belloy, Belgique

Archives

X

pensées nomades
document 4

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

1999. Modifications
Les écrits de Hannah Arendt m’ont particulièrement intéressée au niveau de la pensée humaine, ils m’ont aidée à suivre une pensée de vie qui collait à mon art. Presque chaque jour les écrits sont présents dans ce que j’expérimente et vis. « Concept d’Amour », titre de cette expérience est centré sur sa thèse « Concept d’amour chez Augustin ». Cette conception est « une » vision de sa pensée, j’y place la mutation, la transmission, les commencements renouvelés. Conception sonore.

Pensées

X

pensées nomades
document 5

  • document d'archive

  • document d'archive

  • document d'archive

Souvent je photographie mon espace de travail où s’actionne le mouvement d’une pensée X. Peut-être est-ce une visualisation de tout un questionnement sur la vie et l’art ?

Pensées

X

mon corps, capteur
Document 5

  • document d'archive

  • document d'archive

Je suis, je ne suis plus, je suis l’autre.
Je « désoeuvre » mon être pour le reconstruire ; c’est une action. Les documents photographiques de cette action performative sont mis en circulation formant ainsi d’autres versions.

Corps

X

£
document

  • document d'archive

  • document d'archive

  • document d'archive

  • document d'archive

Marie-Madeleine, peinture de Domineco Fetti. Je collectionne tous les documents qui la représentent pour mieux visualiser l’impact identitaire qu’elle porte sur l’histoire de la femme. Lorsque je l’introduis dans mes expériences, elle semble exister dans un hors–temps. Marie-Madelaine est dans le ou la hors-peinture.

$

X

le spectre de ma voix
_

Une version orale et écrite d’une correspondance. J’ai oralisé ou transcrit une suite de mots qui traduisaient l’idée d’« un » des féminismes. Ces mots ont été échangés par correspondance avec Véronique Danneels. Ils sont inscrits dans la vidéo et enregistrés sur mini–disque puis gravés sur cd pour une transmission orale.

document d'archive
Voix

X

support et diffusion
Art + prostitution

  • document d'archive

Deux femmes à identités plurielles enregistrent
la profondeur de leurs corps. Leurs intériorités
sont explorées au moyen d’une caméra,
d’écrits et d’enregistrements sonores.

Le corps et ses perceptions ultra-sensorielles
sont à la fois outils et réceptacles-laboratoires.
Le monde des deux femmes est enregistré oralement
et mixé par la suite. Leurs identités sont en vase
communicant, c’est la naissance d’un réseau
avec des points de rencontres et de divergences.

Les enregistrements se réalisent dans des lieux réels
ou virtuels porteurs d’expériences méditatives,
tel le jardin philosophique du Musée de la Maison
d’Erasme (Conservateur Alexandre Vanautgaerden,
Bruxelles), une toile du 17ème italien, un texte de
Margueritte Duras, …

Les sons granulaires issus d’une conversation
sont proches d’un proto-langage, leurs diffusions
acousmatiques forment un biotope « extra-ordinaire »
et l’éther qui s’y disperse devient art.

Édition

X

expositions
2006

- 2006
Centre Culturel de Tournai, L’art du Livre, Belgique
Presse: Olivier Bonny, L’Art du livre 1, Reliures contemporaines, livres – objets et installations, coll : Répertoires d’art et de design en Communauté française de Belgique Co - édition éd Labor/ Communauté Française

Archives

X

dessins, apparitions
document

  • document d'archive
Dessin

X

mon corps, capteur
Document 6

  • document d'archive

Contacts intérieurs, notes intimes sont oralisées et diffusées en public dans une réserve précieuse. Je diffuse des « ressentis », des troubles, des silences, des questions existentielles celles de la gestation et de la conception. Utilisation d’une table lumineuse et d’un écran présentant des images d’archives.

Corps

X

£
document

  • document d'archive

  • document d'archive

  • document d'archive

J’ai participé à l’expérience la plus difficile et violente. Un projet social–politique - artistique. Il y avait la femme, la prostitution, l’amour. A trois, nous avons désarticulé l’art et nos vies en créant notre propre langage. Conception sonore : Trois lecteurs de cd. Trois écouteurs. Deux photos. Recherche réalisée dans le cadre du projet Néon – Nord, Art et Prostitution.

$

X

le spectre de ma voix
_

  • document d'archive

  • document d'archive

Les naissances, les morts, les renaissances, l’amour, les désirs, la folie, le secret, les guerres, les blessures actionnent ma vision. Le vide, l’inconscience, l’invention, l’inaccessible, l’impuissance actionnent mon souffle. Tout est là.

Voix

X

supports et diffusion
Correspondances acoustiques

  • document d'archive

  • document d'archive

2 cd, texte, (d£.space), Veronique Danneels.

Édition

X

Expositions
2003

- 2003
Quartier Nord, Néon-Nord Art et Prostitution, Bruxelles, Belgique
Presse:
Human Traffic, Radio Campus, Interview dans le cadre de l’exposition - Néon Nord + Prostitution
Anne Lombarde, RTBF, Intervention Néon Nord, Art + Prostitution, 2003
Hermine Bokhorst, L’art pour réconcilier habitants et prostituées, Le Soir, septembre 2003
Olivier Bonny, NéonNord, Art et Prostitution, des projets artistiques questionnent les clichés, AlterEcho, septembre 2003, n°149

Archives

X

dessins, apparitions
document

  • document d'archive
Dessin

X

mon corps, capteur
Document 7

  • document d'archive

  • document d'archive

Pour émettre ce qui est invisible en mon être,

j’ai créé des sortes de prototypes qui rendent visibles ma pensée, ma mémoire tactile, mon âme. C’est une échographie visionnaire de mon être. Des notes intimes associées à des dessins au crayon graphite sont posées sur des structures lumineuses, elles apparaissent puis disparaissent pour ensuite continuer en boucles.

Corps

X

le spectre de ma voix
_

  • document d'archive

  • document d'archive

J’ai rassemblé par intérêt documentaire tous les documents ayant servi aux expériences sonores. Micro. Tuyau de laboratoire en caoutchouc. Néons. Instrument de laboratoire en verre. Biberon pour agneau en terre. La mélancolie, reproduction de Domenico Fetti. Une côte humaine. Capteur sonore. Ecouteurs. Reproduction, squelette reconstitué de l’homme de Spy (Namur) trouvé en 1886, Institut royal des Sciences naturelles de Belgique. Statuette africaine en bois. Inhalateurs. Livres : actes d’un procès pour viol en 1612 suivis des lettres d’Artemisia Gentileschi éd. Des femmes. L’insoumise, Laure Adler, éd. Actes Sud, (Simone Weil). Carnet de notes. Le Génie féminin, Hannah Arendt, éd. Fayard.

Voix

X

supports et diffusion
XOWd£51

  • document d'archive

DVD : performance « Corpsonde », Musée Art et Marges, Belgique + CD : performance « Hamadryennes », Musée Rops, Belgique.

extrait document d'archive
Voir pdf
Édition

X

expositions
2003/2

- 2003

Château de l’Ermitage, Biennale des artistes du Brabant Wallon, Wavre, Belgique

Archives

X

dessins, apparitions
document

  • document d'archive

XXXSS05 CCCHARLOOOTTE MMM

J’archive des visages. Je les défais. Je défais l’histoire, celle des visages, celle de mon art. Je défais mon geste, ma voix. Je travaille avec des signes, des indices, des icônes : croix, chiffres, morceaux de lignes, ratures. Je travaille avec des ondes, des couches sonores : répétitions acoustiques, bégaiements, saturations. Je voudrais que la langue se perde, s’absente, se vide. Je voudrais arriver à ce que le vide soit une langue. Impuissance.

Dessin

X

mon corps, capteur
_

  • document d'archive

 

2007 . sans titre

Dans cette expérience, je me suis mise dans mon inconscient. C’est l’endroit le plus fort de mon être. J’étais baignée de sang.

Je me sentais aussi proche de la naissance que de la mort. Je m’accouchais et dans un même temps je me faisais violence. Les images projetées en diaporama se succèdent en apparitions et disparitions, elles tournent

en boucle.

document d'archive
Corps

X

expositions
2001

- 2001

Exposition - Performance. Maison de la Poésie, La femme Orale, Namur, Belgique
Presse:
Systole, RTBF, Interview : La femme orale, 2001.
Véronique Danneels, La Femme Orale, L’Art Même n°11, 2001
Olivier Bonny, Réflexion autour de la Femme Orale, Maison de la poésie, Namur, Belgique, 2001

Archives

X

édition vinyle I
Les Soeurs Noires

  • document d'archive

2015. Les Soeurs Noires
Vinyle 12", 180g. Pressage ordinaire à 400 ex. dont une édition limitée à 25 ex. accompagnée d’une reproduction d’un dessin, signé à la main et n° par l’artiste (éd. Delvoyeurs), à l’occasion des expositions au béguinage de la Maison d’Érasme à Anderlecht et à l’église Saint-Jean-Baptiste-au-Béguinage à Bruxelles, organisées en collaboration avec Delvoyeurs, sous le commissariat de François Delvoye.
Musique de Timo van Luijk et daniel duchamP, gravure laser par Dominique Vermeesch.
Version vinyle et numérique seront disponibles via:
Timo van Luijk, http://www.lasciedoree.be/shop
daniel van acker, daniel-vanacker@skynet.be

Édition

X

le spectre de ma voix
_
document d'archive
Voix

X

expositions
2000

- 2000
- Musée de Louvain-La-Neuve, Under Construction, Louvain-La-Neuve, Belgique
- Studio de l’artiste, Under Construction, Louvain-la-Neuve, Belgique
- Musée Royal de Mariemont, Féérie pour un autre Livre, Mariemont, Belgique
Presse: Catherine de Braekeleer, Marie-Blanche Delatre, Pierre-Jean Foulon, Féérie pour un autre livre, Catalogue, Musée Royal de Mariemont, 2000

Archives

X

edition vinyle II
édition vinyle

La pochette du vinyle "Les Soeurs Noires" a été choisie pour figurer dans un édition spéciale dédiée aux meilleures couvertures belges.
L'ouvrage, "Belgium: The Vinyl Frontier pt.2" rédigé par Ben Van Alboom et Francis Weyns est paru aux éd. Borgerhoff & Lamberigts.
Parallèlement, une exposition a lieu à Oostende, Fort-Napoléon jusqu'au 15 Septembre 2016.
https://vinylfrontier.be

Édition

X

expositions
1997

- 1997
- Centre Culturel de Tournais, Livres en Marge Tournais, Belgique
- Musée Royal de Mariemont Performance Dessins Annotés, Réserve Précieuse Mariemont, Belgique

Archives

X

expositions
1996

- 1996
Studio de l’artiste, Dix années de recherches/collaboration avec le Musée de Louvain-La-Neuve, Belgique

Archives

X

support et diffusion
notations-performance

  • doument d'archive

-2019
Notations Performance

Édition

X

presse
média

- Florent Bex, L’Art en Belgique depuis 1975 Fonds Mercator, 2001

- Serge Goyens de Heusch, Art Belge au XX siècle, Racine (Coll. « Fondation pour l’Art belge contemporain »), 2006

- COLLIMATEUR, Périodique aux visées larges n°7, Under construction, page centrale, 2005

- Serge Goyens de Heusch, D’Alechinsky à Wolfs : anthologie chromatique, Edition Margada, 2012

Archives

X

support et diffusion
voix lactée

- 2019
Voix Lactée

Voir pdf
Édition

X

crédit
média

Graphisme : Salutpublic Développement : Bienàvous

X

collections publiques
-

- Réserve précieuse de l'ULB, Bruxelles, Belgique.
- Musée Royal de Mariemont, Belgique
- Province du Brabant Wallon, Belgique
- Musée Art et Marges, Belgique
- Musée Rops, Belgique
- Musée L, Louvain-la-Neuve, Belgique
- Petit Musée des Petits Maîtres, Bruxelles, Belgique

Archives

X

crédits
média

site internet
graphisme: Salutpublic
développement: Bienàvous
image: dominique Vermeesch / daniel Van Acker
vidéo: dominique Vermeesch / daniel Van Acker
son: daniel duchamP

À propos

Restez informé de notre actualité

X